In text display, line wrap is the feature of continuing on a new line when a line is full, such that each line fits in the viewable window, allowing text to be read from top to bottom without any horizontal scrolling.
I am currently wondering what is the difference between the two. When I used both they seem to break the …
css word-wrapDoes any one know how to wrap text in TextView in Android platform. i.e if the text in textview …
android textview word-wrapThe HTML shown below, <input type="text"/> is displayed in a browser like so: When I add the …
html input word-wrapI have a long string (a DNA sequence). It does not contain any whitespace character. For example: ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA What would …
html css string xul word-wrapmy simple textarea doesn't show a horizontal bar when text overflows. It wraps text for a new line. So how …
html textarea word-wrapDoes Visual Studio .NET have a way to toggle word-wrap on and off? I am used to this feature in …
visual-studio word-wrap