How can I force a long string without any blank to be wrapped?

html css string xul word-wrap
Pierre picture Pierre · Jan 31, 2009 · Viewed 156k times · Source

I have a long string (a DNA sequence). It does not contain any whitespace character.

For example:

ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA

What would be the CSS selector to force this text to be wrapped in a html:textarea or in a xul:textbox?

Answer

heeen picture heeen · Jan 31, 2009

for block elements:

<textarea style="width:100px; word-wrap:break-word;">
  ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC
</textarea>

for inline elements:

<span style="width:100px; word-wrap:break-word; display:inline-block;"> 
   ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC
</span>

Related questions

Why doesn't word-wrap work properly in CSS3?

Why doesn't word wrap property work properly in the example below? http://jsfiddle.net/k5VET/739/ What can I do to ensure that part of the word 'consectetur' fits in the first line itself? I want maximum number of characters …

Read More
How can I mimic text-overflow: ellipsis in Firefox?

I have some dynamic text contained in a div that is set to whatever a user enters in a textbox field. If the text doesn't fit in the div, right now it just gets cut off at the edge and …

Read More
How to horizontally center a <div>

How can I horizontally center a <div> within another <div> using CSS? <div id="outer"> <div id="inner">Foo foo</div> </div>

Read More