XUL is an XML-based user interface markup language developed by Mozilla.
I want to have textboxes related to radiobuttons. Therefore each radio button should enable it's textbox and disable the others. …
javascript firefox firefox-addon xulI have a long string (a DNA sequence). It does not contain any whitespace character. For example: ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA What would …
html css string xul word-wrapI've been into Firefox extension development recently, and ran into some issues: So, in browser.xul i defined these lines: &…
javascript firefox firefox-addon xulI am working on a modification of tamper data that will allow me to send the HTTP request/responses it …
javascript checkbox firefox-addon xul setintervalI am creating a Firefox Extension...what would be the javascript to open a URL in the current tab from …
javascript firefox xulI have a problem with my firefox extension I have a XUL popup panel with a hbox for the tag …
dom xul coordinatesI'm not interested in Firebug, a XUL debugger, or a JavaScript editor, but a true WYSIWYG IDE for XUL form …
firefox ide xul