A subset consists of those elements selected from a larger set of elements, by their position in the larger set or other features, such as their value.
Let's say I have a data.table and I want to select all the rows where the variable x has …
r select subset data.tableThis is very similar to a question applying a common function to multiple columns of a data.table uning .SDcols …
r data.table subset lapplyI have a small fasta file of DNA sequences which looks like this: >NM_000016 700 200 234 ACATATTGGAGGCCGAAACAATGAGGCGTGATCAACTCAGTATATCAC >NM_000775 700 124 236 CTAACCTCTCCCAGTGTGGAACCTCTATCTCATGAGAAAGCTGGGATGAG >…
r subset bioinformatics fastaIn a pandas dataframe created like this: import pandas as pd import numpy as np df = pd.DataFrame(np.random.…
r dataframe subset code-conversionI am trying to subset a data frame, where I get multiple data frames based on multiple column values. Here …
r dataframe subset multiple-columnsRelated to this question. gender <- c("F", "M", "M", "F", "F", "M", "F", "F") age <- c(23, 25, 27, 29, 31, 33, 35, 37) …
r row subset random-sampleWhy doesn't subset() work with a logical and && operator combining two conditions? > subset(tt, (customer_id==177 &&…
r subset logical-operators