Read FASTA into a dataframe and extract subsequences of FASTA file

Paul.j picture Paul.j · Jan 21, 2014 · Viewed 31.5k times · Source

I have a small fasta file of DNA sequences which looks like this:

>NM_000016 700 200 234
ACATATTGGAGGCCGAAACAATGAGGCGTGATCAACTCAGTATATCAC

>NM_000775 700 124 236
CTAACCTCTCCCAGTGTGGAACCTCTATCTCATGAGAAAGCTGGGATGAG

>NM_003820 700 111 222
ATTTCCTCCTGCTGCCCGGGAGGTAACACCCTGGACCCCTGGAGTCTGCA

Questions:

1) How can I read this fasta file into R as a dataframe where each row is a sequence record, the 1st column is the refseqID and the 2nd column is the sequence.

2) How to extract subsequence at (start, end) location?

NM_000016 1  3 #"ACA"
NM_000775 2  6 #"TAACC"
NM_003820 3  5 #"TTC"

Answer

sgibb picture sgibb · Jan 21, 2014

You should have a look at the Biostrings package.

library("Biostrings")

s = readDNAStringSet("nm.fasta")
subseq(s, start=c(1, 2, 3), end=c(3, 6, 5))