Writing fasta files using R package seqinr?

r fasta
Jennifer Collins picture Jennifer Collins · Aug 6, 2012 · Viewed 11.3k times · Source

When I use write.fasta in seqinr, the file that it outputs looks like this:

>Sequence name 1

>Sequence name 2

>Sequence name 3
...etc

Sequence 1 Sequence 2 Sequence 3 ...etc

In other words, the sequence names are all at the beginning of the file, and then the sequences are output together at the end of the file.

What I'd like to do is this:

>Sequence name 1
Sequence 1
>Sequence name 2
Sequence 2
>Sequence name 3
Sequence 3
...etc

Is that possible with write.fasta?

Answer

Mayela picture Mayela · Oct 9, 2012

I was having a similar problem. What I did was to convert the vector that contained the sequences to a list and it worked fine.

e.g., write.fasta(as.list(seq),names,file)

Related questions

Read FASTA into a dataframe and extract subsequences of FASTA file

I have a small fasta file of DNA sequences which looks like this: >NM_000016 700 200 234 ACATATTGGAGGCCGAAACAATGAGGCGTGATCAACTCAGTATATCAC >NM_000775 700 124 236 CTAACCTCTCCCAGTGTGGAACCTCTATCTCATGAGAAAGCTGGGATGAG >NM_003820 700 111 222 ATTTCCTCCTGCTGCCCGGGAGGTAACACCCTGGACCCCTGGAGTCTGCA Questions: 1) How can I read this fasta file into R as a dataframe where each row is a …

Read More
Remove rows with all or some NAs (missing values) in data.frame

I'd like to remove the lines in this data frame that: a) contain NAs across all columns. Below is my example data frame. gene hsap mmul mmus rnor cfam 1 ENSG00000208234 0 NA NA NA NA 2 ENSG00000199674 0 2 2 2 2 3 ENSG00000221622 0 NA NA NA NA 4 …

Read More
Drop data frame columns by name

I have a number of columns that I would like to remove from a data frame. I know that we can delete them individually using something like: df$x <- NULL But I was hoping to do this with …

Read More