I am trying to extract a DNA sequence from this FASTA file to a specified length of bases per line, say 40.
> sample dna (This is a typical fasta header.)
agatggcggcgctgaggggtcttgggggctctaggccggccacctactgg
tttgcagcggagacgacgcatggggcctgcgcaataggagtacgctgcct
gggaggcgtgactagaagcggaagtagttgtgggcgcctttgcaaccgcc
tgggacgccgccgagtggtctgtgcaggttcgcgggtcgctggcgggggt
Using this Perl module (fasta.pm):
package fasta;
use strict;
sub read_fasta ($filename) {
my $filename = @_;
open (my $FH_IN, "<", $filename) or die "Can't open file: $filename $!";
my @lines = <$FH_IN>;
chomp @lines;
return @lines;
}
sub read_seq (\@lines) {
my $linesRef = @_;
my @lines = @{$linesRef};
my @seq;
foreach my $line (@lines) {
if ($line!~ /^>/) {
print "$line\n";
push (@seq, $line);
}
}
return @seq;
}
sub print_seq_40 (\@seq) {
my $linesRef = @_;
my @lines = @{$linesRef};
my $seq;
foreach my $line (@lines) {
$seq = $seq.$line;
}
my $i= 0;
my $seq_line;
while (($i+1)*40 < length ($seq)) {
my $seq_line = substr ($seq, $i*40, 40);
print "$seq_line\n";
$i++;
}
$seq_line = substr ($seq, $i*40);
print "$seq_line\n";
}
1;
And the main script is
use strict;
use warnings;
use fasta;
print "What is your filename: ";
my $filename = <STDIN>;
chomp $filename;
my @lines = read_fasta ($filename);
my @seq = read_seq (\@lines);
print_seq_40 (\@seq);
exit;
This is the error I get
Undefined subroutine &main::read_fasta called at q2.pl line 13, <STDIN> line 1.
Can anyone please enlighten me on which part I did wrong?
In Perl, if you use fasta;
, this does not automatically export all its methods into the namespace of your program. Call fasta::read_fasta instead.
Or: use Exporter to automatically export methods or enable something like use Fasta qw/read_fasta/
.
For example:
package Fasta;
require Exporter;
our @ISA = qw(Exporter);
our @EXPORT_OK = qw/read_fasta read_seq read_seq40/;
To use:
use Fasta qw/read_fasta read_seq read_seq40/;
You can also make Fasta export all methods automatically or define keywords to group methods, though the latter has caused me some problems in the past, and I would recommend it only if you are certain it is worth possible trouble.
If you want to make all methods available:
package Fasta;
use Exporter;
our @ISA = qw(Exporter);
our @EXPORT = qw/read_fasta read_seq read_seq40/;
Note @EXPORT is not @EXPORT_OK. The latter allows importing them later (as I did), the former automatically exports all. The documentation I linked to makes this clear.
I just noticed something else. You are flattening @_ into $filename in read_fasta. I am not sure this works. Try this:
sub read_fasta {
my $filename = $_[0]; # or ($filename) = @_; @_ is an array. $filename not.
}
To explain the problem: $filename = @_;
means: store @_ ( an ARRAY ) into $filename (a SCALAR). Perl does this in this way: ARRAY length is stored in $filename. That is not what you want. You want the first element of the array. That would be $_[0].
Added @ISA which is probably needed OR use comment by Borodir.