LaTeX - Adding a varying amount of horizontal spacing to the beginning of each new line in a sequence

latex formatting spacing
Feanor picture Feanor · Feb 6, 2010 · Viewed 40.2k times · Source

I'm using LaTeX for an algorithms assignment and I need to show the steps for Horspool's algorithm for string matching similar to what is shown in the textbook. The way it demonstrates the algorithm is showing how the pattern shifts along the text for each failed comparison, with each shift on a new line. The pattern is shown below the text with appropriate horizontal spacing indicating which letters are being compared.

Here is an example of what it would look like with a DNA sequence:

GAGTAATCCTTCACTTCAAGGCCAGTCTTCACATCTCATCAGA
ACATCTCA
 ACATCTCA
  ACATCTCA
    ACATCTCA

I've poked around on several LaTeX references. I tried using \hspace to add the spacing at the beginning of each line, then adding \hfill after the pattern and before creating a newline. I'm not getting any errors, but there is no space being added at the front. The line is being filled correctly.

Is there another way to add the space to the beginning of each line, or another way to format this?

Answer

Ramashalanka picture Ramashalanka · Feb 6, 2010

Just use \hspace*{5mm} (i.e. the starred form) which works fine at the beginning of a line.

Related questions

LaTeX: set custom line spacing except for some document parts

I need to have a 1.5 line spacing within my document but without some parts like the TOC, title page etc. When I use this command to set the line spacing to 1.5: \renewcommand{\baselinestretch}{1.50}\normalsize the documents line spacing is set …

Read More
Vertical alignment of subfigures LATEX

I am working on my thesis and I am struggling with placing 2 images next to each other, so that the second image would be centered vertically along the first one. I was also trying to use subfigure instead of subfloat …

Read More
How to underline section-headings in LaTeX?

EDIT: As I see in the first answer, underline is the wrong word. I want a line under the section heading, separating the heading from the following text. I want to separate section headings from the following text with a …

Read More